Quickstart

Get the data

Once you have installed RNAglib, you can fetch a pre-built dataset of RNA structures using the command line:

rnaglib_download

By default you will get non-redundant RNA structures saved to ~/.rnaglib.

To obtain different versions or larger sets of RNAs have a look at the command line options rnaglib_download --help.

Load single RNA

Annotations for each RNA are accessed through networkx graph objects. You can load one RNA using graph_from_pdbid()

>>> from rnaglib.utils import available_pdbids
>>> from rnaglib.utils import graph_from_pdbid

>>> pdbids = available_pdbids()
>>> rna = graph_from_pdbid(pdbids[0])
>>> rna
DiGraph with 69 nodes and 194 edges
>>> rna.graph
{'dbn': {'all_chains': {'num_nts': 143, 'num_chars': 144, 'bseq': 'GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCUGGGCAC&CGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGGGC', 'sstr': '(((((((..((((.....[..)))).(((((.......))))).....(((((..]....))))))))))))..&((((..((((.....[..)))).(((((.......))))).....(.(((..]....))).)))))...', 'form': 'AAAAAA...AA...A.......AAA.AAAA.......A.AAA......AAAAA..A....AAAAAAAAAAAA.-&.AA...AA...A.......AAA.AAAA.......A.AAA......AAAAA..A....A...AAAA.A.-'}...,

See the data tutorial for more on the data.

Load an RNA Dataset

For machine learning purposes, we often want a collection of data objects in one place. For that we have the RNADataset object.:

from rnaglib.data_loading import RNADataset

dataset = RNADataset()

This object holds the same objects as above but also supports ML functionalities such as converting the RNAs to different representations (graphs, point clouds, voxels) and to different frameworks (dgl, torch, pytorch geometric) See the ML tutorial for more on model training and tasks.